Double Stranded DNA Questions
Help me study for my Biology class. I’m stuck and don’t understand.
a) Replicate this sense strand to create a double-stranded DNA helix
TCACCATGAAACTCACACCGGGGAAAACTCTTGCACTTATATTCTTGTTCAAGACCTAGTATAACACATTT
b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by finding the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon.
c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below
5’ UTR:
3’ UTR:
