Genetics questions

Genetics questions

Writing Prompt June 17, 2021.

 

1. If a molecule of mRNA has the following nucleotide base sequences, what will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes? Remember, transcription begins with the start codon AUG.

a. AUGGGGAUACGCUACCCC

b. CCGUACAUGCUAAUCCCU

2. Give the mRNA and then the amino acid sequence for the following base sequence in DNA:

TACGGGGGGAGAGGGGGAGGGGGA

 

3. What DNA nucleotides code for the codon UGU? Identify a base pair substitution that would produce a silent mutation at this codon. a base pair substitution that would result in a missense mutation at this codon. And a base-pair substitution that would result in a nonsense mutation at this codon.