Social Cultural Heritage

/in /by

Social Cultural Heritage Questions Page 2

1. Do you speak a language other than English?

2. What is your sociocultural heritage?

3. What major sociocultural events have occurred in your lifetime?

4. What is the demographic profile of the community you grew up in? Has it changed; if so, how has it changed?

5. How would you acquire economic help if necessary?

6. How do you define health?

7. How do you define illness?

8. What do you do to maintain and protect your health?

9. What do you do when you experience a noticeable change in your health?

10. Do you diagnose your own health problems? If yes, how do you do so? If no, why not?

11. From whom do you seek healthcare?

12. What do you do to restore your health? Give examples.

 

the importance of collaboration in your future role as a nurse educator

/in /by

Collaboration is a tool that improves thinking processes and the end work product.

What is the importance of collaboration in your future role as a nurse educator in your chosen practice environment? Who are potential stakeholders involved in your future interprofessional collaborations and define their roles?

Reflect deeply about your experiences thus far. Have you collaborated well with your preceptor. And other important stakeholders? How has the collaboration helped/hindered your lesson planning?

Look to the evidence beyond the readings as you reflect on this DQ!!

Remember to write a detailed response, supported with the evidence to earn full credit. Remember the requirements for substantive responses to earn full credit. Include sources beyond the readings in all of your posts!

The assignment due week 10 focuses on collaboration. The instructions are as follows with my comments in red:

The effective nurse educator collaborates with partners. And the community during the curriculum design process. The purpose of this assignment is to collaborate with your preceptor to refine and enhance your lesson plan.

You may have already delivered your lesson. If so. Think back about the process you went through to develop it. Talk further with your preceptor to discuss the plan!

the importance of collaboration in your future role as a nurse educator

Meet with your preceptor to review your lesson plan. Discuss your lesson plan and possible barriers to successful implementation. Using the comments for refinement from your preceptor, reflect on your collaboration. In 200-350 words, provide a short answer to address the following.

  1. A description of identified areas of reinforcement. Reinforcement: the action or process of reinforcing or strengthening. What areas need to be reinforced? Any additional information you would include? Any strategies that could be improved? Look to the evidence as you reflect!
  2. A description of identified areas of refinement. Refinement: The improvement or clarification of something by the making of small changes. What would you focus on for your refinements? Look to the evidence as you reflect!
  3. Explanation of changes made to the lesson plan with rationale. Describe the changes you will make. Be sure to support them with the evidence.
  4. Explanation of the importance of interprofessional collaboration with involved stakeholders on your lesson plan changes for future implementation. How does collaboration fit within your planning process?

APA style is not required, but solid academic writing is expected.

This assignment uses a rubric. Please review the rubric prior to beginning the assignment to become familiar with the expectations for successful completion.

You are not required to submit this assignment to LopesWrite.

Dorothea Orem Theory Case Study

/in /by

Dorothea Orem Theory Case Study

 When Dan (now 80) and Jane (now 65) began dating more than 15 years ago, both were emotionally charged to begin their lives anew. Well-educated and financially secure, they had a lot in common. Dan was a protestant minister, and Jane’s deceased husband had been a protestant minister. Both had lost their spouses. Jane’s first husband had suffered a catastrophic cerebral aneurysm 2 years earlier. Dan had conducted the funeral service for Jane’s husband. Dan’s wife had died of terminal cancer a little over a year earlier. Dan’s first wife had been a school counselor; Jane was a school teacher. Both had children in college. They shared a love for travel.

Dan was retired but continued part-time employment, and Jane planned to continue teaching to qualify for retirement. Both were in great health and had more than adequate health benefits. Within the year they were married. Summer vacations were spent snorkeling in Hawaii, mountain climbing in national parks, and boating with family. After 7 years, Dan experienced major health problems: a quadruple cardiac bypass surgery, followed by surgery for pancreatic cancer. Jane’s plans to continue working were dropped so she could assist Dan to recover and then continue to travel with him and enjoy their remaining time together. Dan did recover—only to begin to exhibit the early signs and symptoms of Alzheimer’s disease. One of the early signs appeared the previous Christmas as they were hanging outdoor lights.

symptoms of Alzheimer’s disease

To Jane’s dismay, she noted that Dan could not follow the sequential directions she gave him. As time passed, other signs appeared, such as some memory loss and confusion, frequent repeating of favorite phrases, sudden outbursts of anger, and decreased social involvement. Assessments resulted in the diagnosis of early Alzheimer’s disease. Dan was prescribed Aricept, and Jane began to prepare herself to face this new stage of their married life. She read literature about Alzheimer’s disease avidly and organized their home for physical and psychological safety.

A kitchen blackboard displayed phone numbers and the daily schedule. Car keys were appropriately stowed. It was noted that she began to savor her time with Dan. Just sitting together with him on the sofa brought gentle expressions to her face. They continued to attend church services and functions but stopped their regular swims at their exercise facility when Dan left the dressing room naked one day. Within the year, Jane’s retired sister and brother-in-law relocated to a home a short walk from Jane’s. Their intent was to be on call to assist Jane in caring for Dan.

Dorothea Orem Theory Case Study

Dan and Jane’s children did not live nearby so could only assist occasionally. As Dan’s symptoms intensified, a neighbor friend, Helen, began to relieve Jane for a few hours each week. At this time, Jane is still the primary dependent-care agent. She prides herself in mastering a dual shower; she showers Dan in his shower chair first, and then, while she showers, he sits on the nearby toilet seat drying himself. Her girlfriends suggested that this was material for an entertaining home video! Although Jane is cautious in her care for Dan, she often drives a short distance to her neighborhood tennis court for brief games with friends or spends time tending the lovely gardens she and Dan planted. During these times, she locks the house doors and leaves Dan seated in front of the television with a glass of juice.

 dependency cycle model

She watches the time and returns home midway through the hour to check on Dan. On one occasion when she forgot to lock the door while she was gardening, Dan made his way to the street, lost his balance, reclined face-first in the flower bed, and was discovered by a neighbor. Jane has given up evenings out and increased her favorite pastime of reading. Her days are filled with assisting Dan in all of his activities of daily living. And, often, her sleep is interrupted by Dan’s wandering throughout their home. At times, when the phone rings, Dan answers and tells callers Jane is not there. Jane, only in the next room, informs him “Dan, I am Jane.” Friends are saddened by Dan’s decline and concerned with the burdens and limitations Jane has assumed as a result of Dan’s dependency.

1. Examine this case study through the dependency cycle model. The outer arrows show a progression through varying stages of dependency. The inner circle represents who can be involved in the dependency cycle. Where are Jane and Dan in this cycle?

2. Using the basic dependent-care system model, assess Dan and Jane. Identify the basic conditioning factors (BCFs) for each. What is the effect of Dan’s BCFs on his self-care agency? Is he able to meet his therapeutic self-care demands? Continue on to diagnose Dan’s self-care deficit and resulting dependent-care deficit. Now assess Jane’s self-care system.

3. Design a nursing system that addresses Jane’s self-care system as she increases her role as dependent-care agent for Dan.

Planning For Community And Organizational Change

/in /by

3-5 page change proposal to executive leaders, soliciting their support for a change to the health care system in the community you selected in the previous assessment.

Introduction

To improve health care outcomes within a community, leaders must understand the needs of specific populations. In addition, it is important that leaders are able to gather and present persuasive evidence to decision makers to obtain the necessary funding and establish these needs as priorities for budget and resource planning. Thus, proposed changes should support improved outcomes and align with the current or needed health care policy.

This assessment provides an opportunity to propose a community health care change that is based on the community health assessment you completed in Assessment 2.

Preparation

Your community health assessment was well received by the executives at Vila Health. Consequently, they have asked you to recommend a change in the community that will improve health outcomes. They have also asked you to submit your recommendation in a formal change proposal. You are confident that you can present a strong case for change, including a financial plan, that will ensure the success of this initiative.

In thiu can submit all or a portion of your draft change proposal to Smarthinking Tutoring for feedback before you submit the final version for this assessment. If you plan on using this free ses assessment, you will draft a change proposal to executive leaders to solicit support for a change to the current community health care system. To prepare for the assessment, you are encouraged to begin thinking about your justification for establishing the recommended change as a priority, a strategy for leading change, and how the change will be funded.

The following resource is required to complete the assessment.

Vila Health is a virtual environment that simulates a real-world health care system. In the various Vila Health scenarios, you will apply professional strategies, practice skills, and build competencies that you can apply to your coursework and in your career. The information you gather in this scenario will help you to complete the assessment.

TEMPLATES

Use this template for your change proposal.

Requirements

Complete this assessment in two steps:

  1. If you have not already done so, complete the Vila Health: Planning for Change simulation.
  2. Draft a change proposal to justify your recommendation for improving the health of the community and establish the change as a priority for the next budget cycle. Consider the feasibility of your proposed change, in terms of overall scope, funding, and timeframe.

The change proposal requirements outlined below, correspond to the grading criteria in the scoring guide, so be sure to address each point. Read the performance-level descriptions for each criterion to see how your work will be assessed. The Guiding Questions: Planning for Community and Organizational Change document provides additional considerations that may be helpful in completing your assessment. In addition, be sure to note the requirements below for document format and length and for citing supporting evidence.

  • Identify the benefits of proposed health care system changes and its implications for a community.
  • Describe potential barriers to change in an organization or community.
  • Develop;
  • strategies for changing barriers into opportunities and resolving conflict.
  •  a strategy for helping organizational stakeholders understand and evaluate the proposed changes to an existing health care system.
  •  a grant proposal and associated budget for a proposed change to an existing health care system.
  • Write clearly and concisely in a logically coherent and appropriate form and style.
  • Support assertions, arguments, propositions, and conclusions with relevant and credible evidence.
Document Format and Length
  • Use the Change Proposal Template. If you would like to use a different template or document format for your change proposal, obtain prior approval from faculty.
  • Your change proposal should be 3–5 pages in length, not including the title page and references page.
  • Be sure to apply correct APA formatting to all source citations and references.
Supporting Evidence

Cite 3–5 credible sources from peer-reviewed journals or professional industry publications to support your change proposal.

Additional Requirements

Proofread your change proposal before you submit it, to minimize errors that could distract readers and make it more difficult for them to focus on the substance of your analysis.

Portfolio Prompt: You may choose to save your change proposal to your ePortfolio.

Competencies Measured

By successfully completing this assessment, you will demonstrate your proficiency in the following course competencies and assessment criteria:

  • Competency 1: Identify the challenges and opportunities facing health care.
    • Identify the benefits of proposed health care system changes and its implications for a community.
  • Competency 2: Compare the effects of different health care finance models and policy frameworks on resources and patient outcomes.
    • Describe potential barriers to change in an organization or community.
    • Develop a grant proposal and associated budget for a proposed change to an existing health care system.
  • Competency 4: Develop proactive strategies to change the culture of the organization by incorporating evidence-based practices.
    • Develop a strategy for helping organizational stakeholders understand and evaluate the proposed changes to an existing health care system.
    • Develop strategies for changing barriers into opportunities and resolving conflict.
  • Competency 5: Communicate effectively with diverse audiences, in an appropriate form and style consistent with applicable organizational, professional, and scholarly standards.
    • Write clearly and concisely in a logically coherent and appropriate form and style.
    • Support assertions, arguments, propositions, and conclusions with relevant and credible evidence.

psychiatric disorders

/in /by

Respond to 4 people.Include 2 citations and 2 references for each response

 

1.Respond to Kadjatu, include 2 citations and 2 references.

,RE: Discussion – Week 4 reply 1

COLLAPSE

Top of Form

Thank you colleague for your post on OCD,

I would like to offer a reply to your first question: how is OCD related to panic disorder, GAD, and severe phobia?

As with many mental health disorders, OCD shares common features with other psychiatric disorders. Those patients with OCD and anxiety disorders have an underlying common stressor or anxiety that may be real or perceived as real. The difference is the way the stressors present and the rituals of lack of that distinguish between these disorders.  Goodwin (2015)  stated the following:  To demonstrate that there is an overlap between depression, anxiety disorder, and OCD that is likely to rest on shared brain mechanisms, it will be important to consider the evidence for shared genes shared brain mechanisms and shared treatment effects  According to the DSM-5, Recurrent thoughts, avoidant behaviors, and repetitive requests for reassurance can also occur in anxiety disorders.

However, the recurrent thoughts that are present in  GAD  are usually about real-life concerns, whereas the obsessions of OCD usually do not involve real-life concerns and can include content that is odd, irrational, or of a seemingly magical nature. (Apa,2013). It is also important to mention that to properly diagnose and create a treatment plan, the PMHNP must recognize these subtle differences.     Falk, Goldman,  Mohatt (2020)noted that taking into consideration the source of the threat,  the nature of the thoughts, and any reported compulsive behaviors will help in the differential diagnosis. For example,  the source of threat can help distinguish between the various anxiety disorders. According to DSM, the presence or absence of “non-real-life concerns” or content that is “odd, irrational, or of a seemingly magical nature” can often indicate OCD.

 

References

 

American Psychiatric Association. (2013). Diagnostic. And statistical manual of mental disorders (5th ed.). Washington, DC: Author.

 

Falk A, Goldman R,  Mohatt,J (2020).Is It OCD or an Anxiety Disorder? Considerations for Differential Diagnosis. And Treatment. (2020). Retrieved June 23, 2021, from https://www.psychiatrictimes.com/view/it-ocd-or-anxiety-disorder-considerations-differential-diagnosis-and-treatment

 

GooGGoodwin.GM (2015). The overlap between anxiety, depression. And obsessive-compulsive disorder. Dialogues in clinical neuroscience, 17(3), 249–260.  https://doi.org/10.31887/DCNS.2015.17.3/ggoodwin

Bottom of Form

 

 

1. Respond to Christina Vasquez , include 2 citations and 2 referenes.

RE: Discussion – Week 4

COLLAPSE

Top of Form

Thank you very much for your post! I would like to tackle your question about what would I do differentlyy. And why and also discuss about how similar OCD is to panic disorder and anxiety type disorders. According to the DSM 5 patients with OCD are forced to perform repetitive behaviors in response to an obsession (American Psychiatric Association, 2013). These repetitive behaviors  are called compulsions and can help to relieve the anxiety that the patientt is feeling. The obsessions are recurrent unwanted thoughts, images or urges.

In generalized anxiety that worry is excessive and must occur for more than 6 months. And must cause a significant impairment on at least one area of the patients life (American Psychiatric Association, 2013). I believe that both of these disorders can lead to a panic attack or a panic disorder. Panic attacks are intense feelings of fear and or intense worry and can be accompanied by physical symptoms such as, diaphoresis, tachycardia, chest pain and feelings of impending doom (American Psychiatric Association, 2013) .

pharmacological treatments

OCD can be very challenging to treat. And their aren’t many pharmacological treatments that are FDA approved for the treatment of OCD. I do agree that Fluoxetine is a good option and it is  FDA approved for the treatment of OCD for patients over the age of 7. Believe the best treatment option for OCD would include a pharmacological component as well as psychotherapy component. And agree that increasing the Fluoxetine would be a good next step for her but I would also add CBT to her treatment plan. Specifically Exposure and response prevention CBT.

This type of therapy is usually between 12- 24 sessions long and includes a series of planned exposures with the therapist. And also for the client to perform at home (Lack, 2012). Since ERP was recognized as a treatment option for OCD it has been noted as a viable treatment option for those suffering with OCD. (Hezel & Simpson,2019).

Another option that has show efficacy in the treatment of OCD is computer assisted CBT. In a study done all participants showed a reduction in symptoms utilizing the Yale-Brown Obsessive Compulsive Scale. This on line self help model is becoming more popular and has shown significant efficacy ( Kobak, et al., 2015).

 

American Psychiatric Association. (2013). Diagnostic and statistical manual of mental disorders (5th ed.). https://doi.org/10.1176/appi.books.9780890425596

Leadership And Ethics In Health Care

/in /by

The instructor will divide the class into two equal groups. Check the Announcements section of the class for your Group.

Group 1: Support the claim that people should be able to buy organs for transplant if they would not be able to receive an organ by waiting their turn through the national database.

Students must work together with their group in the Discussion Board to either support or refute the topic. Your posts should be collaborative in nature.

Group 2: Refute the claim that people should be able to buy organs for transplant if they would not be able to receive an organ by waiting their turn through the national database.

Students must work together with their group in the Discussion Board to either support or refute the topic. Your posts should be collaborative in nature.

Vegetarian vs. Carnivore Diet

/in /by

Vegetarian vs. Carnivore Diet

It is expected that the market for vegan meat alternatives will hit $7.5 billion globally by 2025. In the US, more and more individuals are decreasing their consumption of meat and milk-based products. Currently 6% of Americans claim to be vegetarian or vegan, depending on your source.

 

For this discussion board, I am not asking you to choose which is “better”- carnivore, omnivore, or herbivore. I challenge you to look at the research and discover what someone following a vegetarian/vegan diet might benefit from this meal plan and some things they might need to consider in order to maintain optimal health while following this meal plan.

 

(In case you like graphics as much as I do, here is a cool WEBSITE (Links to an external site.) to see some statistics.)

 

In this Discussion Board, I want you to read some (more if you choose) of the position paper below. Discuss the questions posed that have an asterisk. For this board, I would like you to show you understand the paper and what we have talked about in our lectures. I would like you to respond to at least 2 other posts. Possibly ask questions to help us really think about the material and how we as future health professionals can address this topic when you (and you will) be asked about healthy diets and plant-based diets.

 

Step 1: read some (more if you choose) of the position paper below. This is a very long position paper from the Academy of Nutrition & Dietetics. You can read it online https://jandonline.org/article/S0002-8223(09)00700-7/fulltext

 

Step 2: Take a look at how a plant-based diet can meet all the requirements for a healthy diet pattern. Answer the following questions.

 

*What do you see as potential pros and cons of limiting animal products from this meal plan?

 

*The Position Paper discusses how a plant-based diet can prevent several disease. Choose one or two diseases and discuss what the finding are.

 

*What is a nutrient that might be missing in a poorly planned plant-based diet? Is Protein one of them?

 

*How might you as a health professional help someone who is following a plant-based diet to do so in the healthiest way possible?

 

Step 3: I would like you to respond to at least 2 other posts. Possibly ask questions to help us really think about the material and how we as future health professionals can address this topic when you (and you will) be asked about healthy diets and plant-based diets.

Genetics questions

/in /by

Genetics questions

Writing Prompt June 17, 2021.

 

1. If a molecule of mRNA has the following nucleotide base sequences, what will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes? Remember, transcription begins with the start codon AUG.

a. AUGGGGAUACGCUACCCC

b. CCGUACAUGCUAAUCCCU

2. Give the mRNA and then the amino acid sequence for the following base sequence in DNA:

TACGGGGGGAGAGGGGGAGGGGGA

 

3. What DNA nucleotides code for the codon UGU? Identify a base pair substitution that would produce a silent mutation at this codon. a base pair substitution that would result in a missense mutation at this codon. And a base-pair substitution that would result in a nonsense mutation at this codon.

Economic Evaluations of Health Programs

/in /by
  • Week 4 DiscussionDiscussion Topic Task: Reply to this topic Due June 24 at 11:59 PMDiscussion Assignment
    The discussion assignment provides a forum for discussing relevant topics for this week based on the course competencies covered.
    For this assignment, make sure you post your initial response to the Discussion Area by the due date assigned.
    To support your work, use your course and text readings and also use outside sources. As in all assignments, cite your sources in your work and provide references for the citations in APA format.
  • Start reviewing and responding to the postings of your classmates as early in the week as possible. Respond to at least two of your classmates. Participate in the discussion by asking a question, providing a statement of clarification, providing a point of view with a rationale, challenging an aspect of the discussion, or indicating a relationship between two or more lines of reasoning in the discussion. Complete your participation for this assignment by the end of week.
    Economic Evaluations of Health Programs
    Program planners and evaluators need a basic understanding of economic evaluation. In addition, they may be faced with certain ethical issues. Interview your local healthcare professionals and evaluators. Based on your interactions, provide responses to the following:

    • Analyze and select two types of economic evaluations. Compare the two evaluations, in relation to the factors that may affect the decision to conduct each of the economic evaluations.
    • Describe at least two potential ethical and social issues related to program implementation.
    • Explain the approach(s) you might take to address these ethical issues.

Ethics In Informatics

/in /by

Paul is a 12 year old male diabetic. He maintains his personal digital assistant (PDA), hand-held device, that interfaces with his glucometer and provides information based on inputted data from him and his parents. This information is transmitted to his MD/hospital, school nurse, case manager (CM), and to the parents’ home computer. All in an attempt to better control his diabetes. You are his CM.

The PDA sends an update to you since Paul’s blood glucose levels have been rising steadily for the last 5 days. The physician has left a message for you to contact this family and have them come in for an evaluation. You know that both of his parents work so you send an e-mail message to the parents’ via their home computer asking them to bring Paul in for an assessment.

Since you are in a hurry and will be seeing other patients when they return from work, you decide to add more information to the message than normal reviewing with them the importance of maintaining control over the diabetes and expressing your concern since Paul has not checked in with you lately. You tell them that you think he might be over-doing it since he is trying to play football. You ask how they are doing and if they are still attending their counseling sessions.

Paul’s 4 year old sister, Lilah, sends your email out to all of the diabetic lists that both Paul and his parents belong. They interact with people on these lists regularly.

The parents are outraged that this information was sent everywhere. Imagine that you are the designated Privacy Officer in a healthcare institution.

Explain the following:

  • How would you feel in this situation?
  • What is the problem? (Clearly state the problem)
  • What ethical principles would guide you in this case?
  • What are the alternatives for solving this dilemma?
  • What are the consequences for each alternative generated?
  • In your opinion, what is the first choice from the alternatives and why?
  • Does your choice take into consideration all of the persons involved and the consequences to each of them?
  • If the worst case scenario would occur based on your choice, could you live with your decision?
  • Based on your choice, what is your plan of action?
  • What types of monitoring procedures would you develop?
  • What would you include in your sanctions for violations policy?
  • How would you address the following?
    • Tracking each point of access of the patient’s database including who entered the data
    • Nurses in your hospital have an access code that only gives them access to their Unit’s patients. A visitor accidentally comes to the wrong unit looking for a patient and asks the nurse to find out what unit the patient is on.

Please submit one APA formatted paper between1800 words, not including the title and reference page. The assignment should have a minimum of Four scholarly sources, in addition to the textbook.